LP711
(Plasmid
#90180)
-
PurposepEGFP-C1 with cDNA encoding HsKIF13B aa residues 1000-1826
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 90180 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 7178
-
Modifications to backboneNone
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameKIF13B
-
Alt nameGAKIN
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2478
-
Mutationaa residues 1000-1826
-
GenBank IDNM_015254.3
-
Entrez GeneKIF13B (a.k.a. GAKIN)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer EGFP-C: CATGGTCCTGCTGGAGTTCGTG
- 3′ sequencing primer SV40pA-R: GAAATTTGTGATGCTATTGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Insert PCR-amplified from plasmid received from Dr. Athar Chishti, Tufts University School of Medicine (pEGFP-C1 with full-length GAKIN/KIF13B; Asaba et al. J. Biol. Chem. 2003, PMID: 12496241)
Addgene's sequencing results found an R1175W mutation in KIF13B compared to the reference sequence NM_015254.3. R1175W is present in the Chishti lab plasmid and does not affect function, as this plasmid rescues the phenotype of KIF13B-/- cells.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LP711 was a gift from Lotte Pedersen (Addgene plasmid # 90180 ; http://n2t.net/addgene:90180 ; RRID:Addgene_90180) -
For your References section:
KIF13B establishes a CAV1-enriched microdomain at the ciliary transition zone to promote Sonic hedgehog signalling. Schou KB, Mogensen JB, Morthorst SK, Nielsen BS, Aleliunaite A, Serra-Marques A, Furstenberg N, Saunier S, Bizet AA, Veland IR, Akhmanova A, Christensen ST, Pedersen LB. Nat Commun. 2017 Jan 30;8:14177. doi: 10.1038/ncomms14177. 10.1038/ncomms14177 PubMed 28134340