LP376
(Plasmid
#90200)
-
PurposepCMV-myc with cDNA encoding HsTRAPPC10 aa residues 1000-1259
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 90200 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMV-Myc
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 3800
- Total vector size (bp) 4657
-
Modifications to backboneNone
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTRAPPC10
-
SpeciesH. sapiens (human)
-
Insert Size (bp)777
-
Mutationaa residues 1000-1259
-
GenBank IDNM_003274.4
-
Entrez GeneTRAPPC10 (a.k.a. TRS30)
- Promoter CMV
-
Tag
/ Fusion Protein
- Myc (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer CMV-F: CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer SV40pA-R: GAAATTTGTGATGCTATTGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LP376 was a gift from Lotte Pedersen (Addgene plasmid # 90200 ; http://n2t.net/addgene:90200 ; RRID:Addgene_90200) -
For your References section:
Identification of conserved, centrosome-targeting ASH domains in TRAPPII complex subunits and TRAPPC8. Schou KB, Morthorst SK, Christensen ST, Pedersen LB. Cilia. 2014 Jun 18;3:6. doi: 10.1186/2046-2530-3-6. eCollection 2014. 2046-2530-3-6 [pii] PubMed 25018876