-
PurposeType I Interferon - ISGF3G (STAT1, STAT2, IRF9) gene reporter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 90402 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLenti7.3
-
Backbone manufacturerThermo Fisher
- Backbone size w/o insert (bp) 7251
- Total vector size (bp) 9293
-
Vector typeLentiviral
-
Selectable markerseGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFirefly luciferase
-
Alt nameLuc2P
-
SpeciesP. pyralis
-
Insert Size (bp)1776
-
GenBank ID
- Promoter GR
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGTACAGTGCAGGGGAAAGA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypGL4.29 reporter vector (Promega)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLminP_Luc2P_RE57 was a gift from Ramnik Xavier (Addgene plasmid # 90402 ; http://n2t.net/addgene:90402 ; RRID:Addgene_90402) -
For your References section:
Simultaneous Pathway Activity Inference and Gene Expression Analysis Using RNA Sequencing. O'Connell DJ, Kolde R, Sooknah M, Graham DB, Sundberg TB, Latorre IJ, Mikkelsen TS, Xavier RJ. Cell Syst. 2016 May 25;2(5):323-34. doi: 10.1016/j.cels.2016.04.011. Epub 2016 May 19. 10.1016/j.cels.2016.04.011 PubMed 27211859