pM9_NR_HD
(Plasmid
#90415)
-
PurposeTALEN Backbone for Phaeodactylum tricornutum_ NR promotor_HD
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 90415 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepPha-NR
-
Backbone manufacturerGenBank_NCBI: JN180663
- Backbone size w/o insert (bp) 3860
- Total vector size (bp) 7011
-
Modifications to backboneSite directed mutagenesis of BsaI Restriction sites, to delete it. Zeocin resistance gene (Sh ble) from the pPha-NR vector was exchanged with the Nourseothricin resistance gene (nat).
-
Vector typePhaeodactylum tricornutum
-
Selectable markersNourseothricin
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTALEN Backbone
-
SpeciesPhaeodactylum tricornutum
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer CCAGTTGCTGAAGATCGCGAAGC
- 3′ sequencing primer TGCCACTCGATGTGATGTCCTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byTale Toolbox Feng Zhang, from Addgene. kit #1000000019
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
N.E. Sanjana, L. Cong, Y. Zhou, M.M. Cunniff, G. Feng, F. Zhang
A transcription activator-like effector toolbox for genome engineering
Nat. Protoc., 7 (2012), pp. 171–192
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pM9_NR_HD was a gift from Peter Kroth (Addgene plasmid # 90415 ; http://n2t.net/addgene:90415 ; RRID:Addgene_90415) -
For your References section:
A fast and reliable strategy to generate TALEN-mediated gene knockouts in the diatom Phaeodactylum tricornutum. Serif M, Lepetit B, Weissert K, Kroth PG, Rio Bartulos C. Algal Research Volume 23, April 2017, Pages 186–195 10.1016/j.algal.2017.02.005