Skip to main content

pLXSN p110 CUX1
(Plasmid #90471)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 90471 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLXSN
  • Backbone manufacturer
    Miller, A.D.
  • Backbone size w/o insert (bp) 5875
  • Total vector size (bp) 8240
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CUX1 (amino acids 747-1505)
  • Alt name
    CCAAT-displacement protein
  • Alt name
    Cut-like 1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2368
  • GenBank ID
    M74099
  • Entrez Gene
    CUX1 (a.k.a. CASP, CDP, CDP/Cut, CDP1, COY1, CUTL1, CUX, Clox, Cux/CDP, GDDI, GOLIM6, Nbla10317, p100, p110, p200, p75)
  • Promoter Moloney murine leukemia virus long terminal repeat
  • Tags / Fusion Proteins
    • Myc (N terminal on insert)
    • HA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HpaI (not destroyed)
  • 3′ cloning site HpaI (not destroyed)
  • 5′ sequencing primer GTCTCTCCCCCTTGAACC
  • 3′ sequencing primer CCACACCCTAACTGACACAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLXSN p110 CUX1 was a gift from Alain Nepveu (Addgene plasmid # 90471 ; http://n2t.net/addgene:90471 ; RRID:Addgene_90471)
  • For your References section:

    p110 CUX1 homeodomain protein stimulates cell migration and invasion in part through a regulatory cascade culminating in the repression of E-cadherin and occludin. Kedinger V, Sansregret L, Harada R, Vadnais C, Cadieux C, Fathers K, Park M, Nepveu A. J Biol Chem. 2009 Oct 2;284(40):27701-11. doi: 10.1074/jbc.M109.031849. Epub 2009 Jul 27. 10.1074/jbc.M109.031849 PubMed 19635798