pKD184
(Plasmid
#90953)
-
PurposeExpresses ThsR under the PltetO-1 promoter, sfGFP under PphsA, and mCherry constitutively
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 90953 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneColE1
- Total vector size (bp) 5684
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameThiosulfate response regulator
-
Alt nameThsR
-
SpeciesShewanella halifaxensis HAW-EB4
-
Insert Size (bp)612
-
GenBank IDABZ77676
- Promoter PltetO-1
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CGTCTAAGAAACCATTATTATCATGACATTAAC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameSuperfolder GFP
-
Alt namesfGFP
-
SpeciesSynthetic
-
Insert Size (bp)720
- Promoter PphsA
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer CCGTTCTGGATAATGTTTTTTGCG (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namemCherry
-
SpeciesSynthetic
-
Insert Size (bp)711
- Promoter Bba_J23114
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer GCTTCCTTAGCTCCTGAAAATCTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKD184 was a gift from Jeffrey Tabor (Addgene plasmid # 90953 ; http://n2t.net/addgene:90953 ; RRID:Addgene_90953) -
For your References section:
Engineering bacterial thiosulfate and tetrathionate sensors for detecting gut inflammation. Daeffler KN, Galley JD, Sheth RU, Ortiz-Velez LC, Bibb CO, Shroyer NF, Britton RA, Tabor JJ. Mol Syst Biol. 2017 Apr 3;13(4):923. doi: 10.15252/msb.20167416. PubMed 28373240