-
PurposeExpresses ThsS constitutively
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 90956 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonep15A
- Total vector size (bp) 4049
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameThsS
-
SpeciesShewanella halifaxensis
-
Insert Size (bp)1785
-
GenBank IDABZ77675
- Promoter Bba_J23104
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGGTATCAGCTCACTCAAAGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKD236-4b was a gift from Jeffrey Tabor (Addgene plasmid # 90956 ; http://n2t.net/addgene:90956 ; RRID:Addgene_90956) -
For your References section:
Engineering bacterial thiosulfate and tetrathionate sensors for detecting gut inflammation. Daeffler KN, Galley JD, Sheth RU, Ortiz-Velez LC, Bibb CO, Shroyer NF, Britton RA, Tabor JJ. Mol Syst Biol. 2017 Apr 3;13(4):923. doi: 10.15252/msb.20167416. PubMed 28373240