pADH143
(Plasmid
#90989)
-
PurposeNAT-marked "empty" gRNA expression construct; part 2 of 2 of C.mal LEUpOUT CRISPR system. Use with pADH140 CAS9 expression construct.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 90989 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUC19
- Backbone size w/o insert (bp) 2242
- Total vector size (bp) 4150
-
Vector typeCRISPR
-
Selectable markersNourseothricin (NAT)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNAT 2 of 2, pSNR52, empty gRNA, gRNA conserved, C. mal LEU2 2 of 2
-
gRNA/shRNA sequenceTCTATAGTACAGATGCCAAG
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pADH143 was a gift from Aaron Hernday (Addgene plasmid # 90989 ; http://n2t.net/addgene:90989 ; RRID:Addgene_90989) -
For your References section:
An Efficient, Rapid, and Recyclable System for CRISPR-Mediated Genome Editing in Candida albicans. Nguyen N, Quail MMF, Hernday AD. mSphere. 2017 Apr 26;2(2):e00149-17. doi: 10.1128/mSphereDirect.00149-17. eCollection 2017 Mar-Apr. 10.1128/mSphereDirect.00149-17 PubMed 28497115