pADH143
(Plasmid
#90989)
-
PurposeNAT-marked "empty" gRNA expression construct; part 2 of 2 of C.mal LEUpOUT CRISPR system. Use with pADH140 CAS9 expression construct.
-
Depositing Lab
-
Depositing OrganizationUniversity of California, Merced
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 90989 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 90989-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 90989-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepUC19
- Backbone size w/o insert (bp) 2242
- Total vector size (bp) 4150
-
Vector typeCRISPR
-
Selectable markersNourseothricin (NAT)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNAT 2 of 2, pSNR52, empty gRNA, gRNA conserved, C. mal LEU2 2 of 2
-
gRNA/shRNA sequenceTCTATAGTACAGATGCCAAG
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 90989-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 90989-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pADH143 was a gift from Aaron Hernday (Addgene plasmid # 90989 ; http://n2t.net/addgene:90989 ; RRID:Addgene_90989) -
For your References section:
An Efficient, Rapid, and Recyclable System for CRISPR-Mediated Genome Editing in Candida albicans. Nguyen N, Quail MMF, Hernday AD. mSphere. 2017 Apr 26;2(2):e00149-17. doi: 10.1128/mSphereDirect.00149-17. eCollection 2017 Mar-Apr. 10.1128/mSphereDirect.00149-17 PubMed 28497115