pJG493
(Plasmid
#91197)
-
PurposeWDV replicon T-DNA for gene targeting in wheat scutella, no Cas9 control (gUbi1+gUbi8+donor)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 91197 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTRANS_203
-
Vector typePlant Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegUbi1+gUbi8+donor
-
gRNA/shRNA sequencegUbi1: GCTGGTGCAACTGGTGGCCC, gUbi8: GCCAGCCCTGGGACTAGCAGC
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer unknown (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJG493 was a gift from Daniel Voytas (Addgene plasmid # 91197 ; http://n2t.net/addgene:91197 ; RRID:Addgene_91197) -
For your References section:
A multi-purpose toolkit to enable advanced genome engineering in plants. Cermak T, Curtin SJ, Gil-Humanes J, Cegan R, Kono TJY, Konecna E, Belanto JJ, Starker CG, Mathre JW, Greenstein RL, Voytas DF. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922. 10.1105/tpc.16.00922 PubMed 28522548