Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBabe-Tet-off-puro-mCherry-PA(wt)-Vav2
(Plasmid #91873)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 91873 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBABE
  • Total vector size (bp) 7200
  • Vector type
    Mammalian Expression, Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    LOV2
  • Species
    Synthetic
  • Insert Size (bp)
    447
  • Tag / Fusion Protein
    • mCherry (N terminal on backbone)

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer GAGATCAAGCAGAGGCTGAAG
  • 3′ sequencing primer AAGTTCTTTTGCCGCCTCATC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    VAV2 DH/PH/ZF
  • Alt name
    VAV2
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1200
  • Entrez Gene
    Vav2 (a.k.a. 2810040F13Rik, AI847175, Vav-2)

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer GAGATCAAGCAGAGGCTGAAG
  • 3′ sequencing primer AAGTTCTTTTGCCGCCTCATC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBabe-Tet-off-puro-mCherry-PA(wt)-Vav2 was a gift from Klaus Hahn (Addgene plasmid # 91873 ; http://n2t.net/addgene:91873 ; RRID:Addgene_91873)
  • For your References section:

    Engineering extrinsic disorder to control protein activity in living cells. Dagliyan O, Tarnawski M, Chu PH, Shirvanyants D, Schlichting I, Dokholyan NV, Hahn KM. Science. 2016 Dec 16;354(6318):1441-1444. 10.1126/science.aah3404 PubMed 27980211