pCOTS-pyl-GFP(35TAG)
(Plasmid
#92047)
-
PurposeThis is a S. elongatus (PCC7942) cyanobacterial plasmid that encodes the pylRS orthogonal translation system. In addition it encodes for a GFP reporter with TAG mutation at site 35.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 92047 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCB4
- Backbone size w/o insert (bp) 7500
- Total vector size (bp) 14807
-
Modifications to backboneIn addition to E. coli origin, we have introduced the 2micron yeast origin and URA3 marker to enable genetic engineering using yeast assembly.
-
Vector typeReplicative expression plasmid for cyanobacteria S. elongatus (PCC7942).
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsThere is also spect and URA3 markers encoded in this vector.
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameEGFP
-
Insert Size (bp)720
-
MutationTyrosine in position 35 of the GFP was mutated from TAC to TAG to facilitate incorporation of unnatural amino acid
- Promoter PpsbII
-
Tag
/ Fusion Protein
- Histag (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CCTTGGGCGATCGCTCTAAAC
- 3′ sequencing primer GCAAAATTAGCTGAGGGCG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namePyrrolysyl tRNA(cua)
-
Alt namePyl-tRNA
-
SpeciesMethanosarcina mazei
-
Insert Size (bp)72
- Promoter LeuP (native S. elongatus promoter)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer GTATTAGGCAAATGCCAGTTAC
- 3′ sequencing primer GTAAACCGCGAAGGTCGTGAAGG (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namePyrrolysyl tRNA synthetase (methanosarcina mazei)
-
Alt namePylRS
-
SpeciesMethanosarcina mazei
-
Insert Size (bp)1365
- Promoter PrcbL
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer GCACACCACGTAATTTG
- 3′ sequencing primer CACAGGAAACAGCTATGACC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCOTS-pyl-GFP(35TAG) was a gift from Lital Alfonta (Addgene plasmid # 92047 ; http://n2t.net/addgene:92047 ; RRID:Addgene_92047) -
For your References section:
Expanding the Genetic Code of a Photoautotrophic Organism. Chemla Y, Friedman M, Heltberg M, Bakhrat A, Nagar E, Schwarz R, Jensen MH, Alfonta L. Biochemistry. 2017 Apr 12. doi: 10.1021/acs.biochem.7b00131. 10.1021/acs.biochem.7b00131 PubMed 28394580