gCOTS-pyl
(Plasmid #92048)

• Purpose: This is a S. elongatus (PCC7942) shuttle vector used for recombination of the pylRS orthogonal translation system to genomic neutral site 2.
• Depositing Lab: Lital Alfonta
• Publication: Chemla et al Biochemistry. 2017 Apr 12. doi: 10.1021/acs.biochem.7b00131.

Backbone

• Vector backbone: pAM1573
• Backbone size w/o insert (bp): 7000
• Total vector size (bp): 11776
• Modifications to backbone: In addition to E. coli origin, we have introduced the 2micron yeast origin and UTA3 marker to enable genetic engineering using yeast assembly.
• Vector type: Cyanobacteria S. elongatus genome recombination into neutral site 2
• Selectable markers: URA3

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Amp resistace in E. coli, inrecombination in S. elongatus use cmp as marker selection. Use final concentration of 10ug/ml cmp for selection.
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: Pyrrolysyl tRNA(cua)
• Alt name: Pyl-tRNA
• Species: Methanosarcina mazei
• Insert Size (bp): 72
• Promoter: LeuP (native S. elongatus promoter)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GTATTAGGCAAATGCCAGTTAC
• 3′ sequencing primer: GTAAACCGCGAAGGTCGTGAAGG

Gene/Insert 2

• Gene/Insert name: Pyrrolysyl tRNA synthetase (methanosarcina mazei)
• Alt name: PylRS
• Species: Methanosarcina mazei
• Insert Size (bp): 1365
• Promoter: PrcbL

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GCACACCACGTAATTTG
• 3′ sequencing primer: CACAGGAAACAGCTATGACC

Resource Information

• Supplemental Documents:
  • gCOTS-pyl.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The depositor notes that discrepancies between the Genbank file and Addgene's QC should not have functional consequences.