C-BLa 2.0
(Plasmid
#92060)
-
PurposeThe C-BLa 2.0 plasmid encodes a protein, where the TMD is connected to the C-terminus of the cytoplasmic domain of the ToxR protein and to the N-terminus of the C-terminal beta-lactamase fragment.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 92060 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBAD322K (modified)
-
Backbone manufacturerJohn E. Cronan
- Backbone size w/o insert (bp) 4284
- Total vector size (bp) 5253
-
Modifications to backboneDeletion 4246–4454/0–2
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameC-BLa 2.0 fusion protein
-
SpeciesSynthetic
-
Insert Size (bp)969
- Promoter araBAD
-
Tag
/ Fusion Protein
- Flag (DYKDHDG) (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GCATTCTGTAACAAAGCGGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
TMD: Integrin alphaV mut GP, contains ApaI restriction site
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
C-BLa 2.0 was a gift from Dieter Langosch (Addgene plasmid # 92060 ; http://n2t.net/addgene:92060 ; RRID:Addgene_92060) -
For your References section:
BLaTM 2.0, a genetic tool revealing preferred antiparallel interaction of transmembrane helix 4 of the dual-topology protein EmrE. Julius A, Laur L, Schanzenbach C, Langosch D. J Mol Biol. 2017 Apr 18. pii: S0022-2836(17)30166-3. doi: 10.1016/j.jmb.2017.04.003. 10.1016/j.jmb.2017.04.003 PubMed 28432015