Skip to main content

BPTF PHD and Bromodomain
(Plasmid #92101)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 92101 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGEX-6P-2
  • Backbone size w/o insert (bp) 4985
  • Total vector size (bp) 5501
  • Vector type
    Bacterial Expression
  • Selectable markers
    Chloramphenicol

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    BL21 Codon plus strain should be used for expression
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PHD and Bromodomain
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    507
  • GenBank ID
    GI 31322942
  • Entrez Gene
    BPTF (a.k.a. FAC1, FALZ, NEDDFL, NURF301)
  • Promoter tac promoter
  • Tag / Fusion Protein
    • GST Tag

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG
  • 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    BPTF PHD and Bromodomain was a gift from Albert Jeltsch (Addgene plasmid # 92101 ; http://n2t.net/addgene:92101 ; RRID:Addgene_92101)
  • For your References section:

    Application of mixed peptide arrays to study combinatorial readout of chromatin modifications. Mauser R, Kungulovski G, Meral D, Maisch D, Jeltsch A. Biochimie. 2018 Mar;146:14-19. doi: 10.1016/j.biochi.2017.11.008. Epub 2017 Nov 11. 10.1016/j.biochi.2017.11.008 PubMed 29133117