Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pX330-Flag-dSpCas9-HF1
(Plasmid #92115)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 92115 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pX330-like (without U6-sgRNA coding sequence)
  • Total vector size (bp) 8077
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dead/inactive SpCas9-HF1 with FLAG tag
  • Species
    S. pyogenes
  • Insert Size (bp)
    4272
  • Mutation
    D10A, N497A, R661A, Q695A, H840A, Q926A
  • Promoter Cbh
  • Tags / Fusion Proteins
    • 3xFLAG (N terminal on insert)
    • NLS (N terminal on insert)
    • NLS (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer gggtggagtatttacggtaaactgcccacttgg
  • 3′ sequencing primer CGGCGTACTGGTCGCCGATC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Alternate plasmid name: pCbh-3xFLAG-NLS-dSpCas9-HF1-NLS (without U6-sgRNA coding sequence).

For detailed information and plasmid usage, please see the associated publication.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330-Flag-dSpCas9-HF1 was a gift from Ervin Welker (Addgene plasmid # 92115 ; http://n2t.net/addgene:92115 ; RRID:Addgene_92115)
  • For your References section:

    Crossing enhanced and high fidelity SpCas9 nucleases to optimize specificity and cleavage. Kulcsar PI, Talas A, Huszar K, Ligeti Z, Toth E, Weinhardt N, Fodor E, Welker E. Genome Biol. 2017 Oct 6;18(1):190. doi: 10.1186/s13059-017-1318-8. 10.1186/s13059-017-1318-8 [pii] PubMed 28985763