Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

CMV-sgE1TSS-short-3'box
(Plasmid #92165)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 92165 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA3.1
  • Vector type
    CRISPR
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Evx1as short isoform
  • gRNA/shRNA sequence
    gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctttt
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    621
  • Promoter CMV

Cloning Information

  • Cloning method Unknown

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that there are some discrepancies between Addgene's quality control sequence and the depositor's sequence. The depositor noted that these discrepancies do NOT affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CMV-sgE1TSS-short-3'box was a gift from Xiaohua Shen (Addgene plasmid # 92165 ; http://n2t.net/addgene:92165 ; RRID:Addgene_92165)
  • For your References section:

    Divergent lncRNAs Regulate Gene Expression and Lineage Differentiation in Pluripotent Cells. Luo S, Lu JY, Liu L, Yin Y, Chen C, Han X, Wu B, Xu R, Liu W, Yan P, Shao W, Lu Z, Li H, Na J, Tang F, Wang J, Zhang YE, Shen X. Cell Stem Cell. 2016 May 5;18(5):637-52. doi: 10.1016/j.stem.2016.01.024. Epub 2016 Mar 17. 10.1016/j.stem.2016.01.024 PubMed 26996597