BtuF
(Plasmid #92209)

• Purpose: Expression of BtuF which is the vitamin B12 binding protein for BtuCD ABC Transporter
• Depositing Lab: Douglas Rees
• Publication: Borths et al Proc Natl Acad Sci U S A. 2002 Dec 24;99(26):16642-7. Epub 2002 Dec 10.

Backbone

• Vector backbone: pET22b(+)
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 5406
• Total vector size (bp): 6207
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: BtuF
• Alt name: Vitamin B12 Binding Protein
• Alt name: vitamin B12 ABC transporter periplasmic binding protein
• Insert Size (bp): 774
• Mutation: BtuF signal sequence removed and uses the PelB signal sequence
• GenBank ID: 947574
• Entrez Gene: btuF (a.k.a. b0158, ECK0157, JW0154, yadT)
• Promoter: T7 Promoter
• Tags / Fusion Proteins:
  • 6x His Tag (C terminal on insert)
  • PelB Signal Sequence (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (unknown if destroyed)
• 3′ cloning site: XhoI (unknown if destroyed)
• 5′ sequencing primer: taatacgactcactataggg
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Resource Information

• Supplemental Documents:
  • cy-e-coli-btuf.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry