Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

MolBC
(Plasmid #92210)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 92210 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pET21b(+)
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 4900
  • Total vector size (bp) 6763
  • Modifications to backbone
    Added the entire expression section of pET19b + MolC into pET21b(+) vector
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    MolC
  • Alt name
    H. influenzae ABC Transporter
  • Alt name
    HI1471
  • Entrez Gene
    HI1471 (a.k.a. HI1471)
  • Promoter T7 Promoter
  • Tags / Fusion Proteins
    • 8x Histidine Tag (N terminal on insert)
    • Enterokinase Cleavage Site between Histidine Tag and MolB (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer gccgttgagcaccgccgccgcaaggaatgg
  • 3′ sequencing primer cacgatatccaatacggaata
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    MolB
  • Alt name
    H. influenzae ABC Transporter
  • Alt name
    HI1470
  • Entrez Gene
    HI1470 (a.k.a. HI1470)
  • Promoter T7 Promoter

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (unknown if destroyed)
  • 3′ cloning site NdeI (unknown if destroyed)
  • 5′ sequencing primer tggttgatggggagttttgc
  • 3′ sequencing primer T7 Terminator
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MolBC was a gift from Douglas Rees (Addgene plasmid # 92210 ; http://n2t.net/addgene:92210 ; RRID:Addgene_92210)
  • For your References section:

    An inward-facing conformation of a putative metal-chelate-type ABC transporter. Pinkett HW, Lee AT, Lum P, Locher KP, Rees DC. Science. 2007 Jan 19;315(5810):373-7. Epub 2006 Dec 7. 10.1126/science.1133488 PubMed 17158291