Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is operating at a reduced capacity.

  • Pending order? We will email to confirm that your organization can accept shipments.
  • Conducting coronavirus or COVID-19 research? Email us at [email protected] with your order or deposit number so we can prioritize it.

Learn more about our current shipping status and COVID-19 resources.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #92234)


Item Catalog # Description Quantity Price (USD)
Plasmid 92234 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    DNA 2.0
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 6229
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    Prolyl oligopeptidase B from Galerina marginata
  • Alt name
  • Species
    Galerina marginata
  • Insert Size (bp)
  • Mutation
  • GenBank ID
  • Promoter T7 promoter
  • Tag / Fusion Protein
    • 6x-Histag, TEV cleavage site (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer TTAATACGACTCACTATAGG
  • 3′ sequencing primer AAACCCCTCAAGACC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJExpress414_GmPOPB was a gift from James Naismith (Addgene plasmid # 92234 ; ; RRID:Addgene_92234)
  • For your References section:

    Kinetic Landscape of a Peptide Bond-Forming Prolyl Oligopeptidase. Czekster CM, Naismith JH. Biochemistry. 2017 Apr 18;56(15):2086-2095. doi: 10.1021/acs.biochem.7b00012. Epub 2017 Apr 7. 10.1021/acs.biochem.7b00012 PubMed 28332820