USPQ-HTT-TALEN2
(Plasmid
#92244)
-
PurposeTALEN targeting upstream of HTT gene (ELD), forms obligate heterodimer with USPQ-HTT-TALEN1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 92244 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepcDNA4/myc-hisA
- Backbone size w/o insert (bp) 5055
-
Vector typeTALEN
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTALEN
-
SpeciesSynthetic
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site PmeI (destroyed during cloning)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
USPQ-HTT-TALEN2 was a gift from Mahmoud Pouladi (Addgene plasmid # 92244 ; http://n2t.net/addgene:92244 ; RRID:Addgene_92244) -
For your References section:
Unbiased Profiling of Isogenic Huntington Disease hPSC-Derived CNS and Peripheral Cells Reveals Strong Cell-Type Specificity of CAG Length Effects. Ooi J, Langley SR, Xu X, Utami KH, Sim B, Huang Y, Harmston NP, Tay YL, Ziaei A, Zeng R, Low D, Aminkeng F, Sobota RM, Ginhoux F, Petretto E, Pouladi MA. Cell Rep. 2019 Feb 26;26(9):2494-2508.e7. doi: 10.1016/j.celrep.2019.02.008. 10.1016/j.celrep.2019.02.008 PubMed 30811996