Skip to main content
Addgene

pJOP-HTT-HR81Q
(Plasmid #92250)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 92250 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PBHR100A-1 (SBI)
  • Backbone size w/o insert (bp) 7925
  • Vector type
    PrecisionX HR targeting vector
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HTT donor DNA
  • Species
    H. sapiens (human)
  • Mutation
    Barcode of wobble bases to prevent TALEN cleaving donor DNA: CAC CTG CCC CAC CCG CC
  • Entrez Gene
    HTT (a.k.a. HD, IT15, LOMARS)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI/NotI (not destroyed)
  • 3′ cloning site BspQI (destroyed)/SpeI (destroyed during cloning)
  • 5′ sequencing primer GTTTCGCCACCTCTGACTTG (-588)
  • 3′ sequencing primer TCATTTTGACTCACGCGGTC (-196)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJOP-HTT-HR81Q was a gift from Mahmoud Pouladi (Addgene plasmid # 92250 ; http://n2t.net/addgene:92250 ; RRID:Addgene_92250)
  • For your References section:

    Unbiased Profiling of Isogenic Huntington Disease hPSC-Derived CNS and Peripheral Cells Reveals Strong Cell-Type Specificity of CAG Length Effects. Ooi J, Langley SR, Xu X, Utami KH, Sim B, Huang Y, Harmston NP, Tay YL, Ziaei A, Zeng R, Low D, Aminkeng F, Sobota RM, Ginhoux F, Petretto E, Pouladi MA. Cell Rep. 2019 Feb 26;26(9):2494-2508.e7. doi: 10.1016/j.celrep.2019.02.008. 10.1016/j.celrep.2019.02.008 PubMed 30811996