pMCh-665
(Plasmid
#92254)
-
PurposePlasmid for expression of GST-tagged human TNRC6C 7W7A CED with seven mutated W-motifs and mutated PAM2 motif in mammalian cells
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 92254 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEBG
-
Backbone manufacturerAddgene 22227
- Backbone size w/o insert (bp) 5996
- Total vector size (bp) 6965
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTNRC6C CED
-
SpeciesH. sapiens (human)
-
Insert Size (bp)969
-
MutationC-terminal effector domain (CED): aa 1369-1690 with the following point mutations: EF1388AA; W1445A; W1487A;W1494A; W1504A; W1605A; W1648A; W1659A
-
GenBank IDNM_001142640.1
-
Entrez GeneTNRC6C
- Promoter EF1A
-
Tag
/ Fusion Protein
- GST (N terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer atagcatggcctttgcaggg
- 3′ sequencing primer ACAGGGATTTCTTGTCTCCCAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMCh-665 was a gift from Marina Chekulaeva & Witold Filipowicz (Addgene plasmid # 92254 ; http://n2t.net/addgene:92254 ; RRID:Addgene_92254) -
For your References section:
miRNA repression involves GW182-mediated recruitment of CCR4-NOT through conserved W-containing motifs. Chekulaeva M, Mathys H, Zipprich JT, Attig J, Colic M, Parker R, Filipowicz W. Nat Struct Mol Biol. 2011 Oct 7;18(11):1218-26. doi: 10.1038/nsmb.2166. 10.1038/nsmb.2166 PubMed 21984184