pcU6_1 sgRNA
(Plasmid
#92395)
-
PurposeChicken-specific U6 sgRNA expression mini-vector, harbouring chick U6_1 pol III promoter.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 92395 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepNG1
- Backbone size w/o insert (bp) 3017
- Total vector size (bp) 3493
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Tetracycline, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namechick U6.1 promoter and gRNA cloning cassette
-
SpeciesG. gallus (chicken)
-
Insert Size (bp)476
- Promoter chick U6.1
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gatcaagcctgattgggagaa (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bychick U6.1 promoter (Kudo and Sutou, 2005) was cloned into BsaI sites in pNG1 vector #30985-8
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Kudo, T., and S. Sutou. 2005. Usage of putative chicken U6 promoters for vector-based RNA interference. J Reprod Dev. 51:411-417.
Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. Cermak T, Doyle EL, Christian M, Wang L, Zhang Y, Schmidt C, Baller JA, Somia NV, Bogdanove AJ, Voytas DF. Nucleic Acids Res. 2011 Apr 14. ():. 10.1093/nar/gkr218 PubMed 21493687
Please visit https://www.biorxiv.org/content/early/2017/05/08/135525 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcU6_1 sgRNA was a gift from Tatjana Sauka-Spengler (Addgene plasmid # 92395 ; http://n2t.net/addgene:92395 ; RRID:Addgene_92395) -
For your References section:
Genome and epigenome engineering CRISPR toolkit for in vivo modulation of cis-regulatory interactions and gene expression in the chicken embryo. Williams RM, Senanayake U, Artibani M, Taylor G, Wells D, Ahmed AA, Sauka-Spengler T. Development. 2018 Feb 23;145(4). pii: dev.160333. doi: 10.1242/dev.160333. 10.1242/dev.160333 PubMed 29386245