Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #92426)


Item Catalog # Description Quantity Price (USD)
Plasmid 92426 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Modifications to backbone
    mCitrine with BamHI restriction sites on both sides was subcloned in the Stx3-mCherry construct
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
    syntaxin 3, syntaxin-3
  • Species
    R. norvegicus (rat)
  • GenBank ID
  • Entrez Gene
    Stx3 (a.k.a. Stx3a)
  • Promoter CMV
  • Tags / Fusion Proteins
    • mCitrine (C terminal on insert)
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TAACAACTCCGCCCCATT
  • 3′ sequencing primer CACCTTGAAGCGCATGAACT
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Stx3-mCitrine-mCherry was a gift from Geert van den Bogaart (Addgene plasmid # 92426 ; ; RRID:Addgene_92426)
  • For your References section:

    Fluorescence lifetime imaging microscopy reveals rerouting of SNARE trafficking driving dendritic cell activation. Verboogen DRJ, Gonzalez Mancha N, Ter Beest M, van den Bogaart G. Elife. 2017 May 19;6. pii: e23525. doi: 10.7554/eLife.23525. 10.7554/eLife.23525 PubMed 28524818