-
Purposeexpression of Flag-tagged human MBNL3
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 96901 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepcDNA3.1 HisC
- Backbone size w/o insert (bp) 5387
- Total vector size (bp) 6444
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman MBNL3 cDNA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1057
-
Entrez GeneMBNL3 (a.k.a. CHCR, MBLX, MBLX39, MBXL)
- Promoter CMV
-
Tag
/ Fusion Protein
- Flag
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (destroyed during cloning)
- 3′ cloning site ApaI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATA
- 3′ sequencing primer CAGAATAGAATGACACCTAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FlagMBNL3 was a gift from Thomas Cooper (Addgene plasmid # 96901 ; http://n2t.net/addgene:96901 ; RRID:Addgene_96901) -
For your References section:
A bichromatic fluorescent reporter for cell-based screens of alternative splicing. Orengo JP, Bundman D, Cooper TA. Nucleic Acids Res. 2006;34(22):e148. Epub 2006 Nov 16. 10.1093/nar/gkl967 PubMed 17142220