pBItetDMPKSGFP
(Plasmid
#96903)
-
Purposetet inducible bidirectional plasmid expressing GFP in one direction and in the other a human DMPK genomic segment containing exons 11-15 with 0 CTG repeats in exon 15 located
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 96903 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBiTet
- Backbone size w/o insert (bp) 2800
- Total vector size (bp) 7100
-
Vector typeMammalian Expression ; tetracycline responsive and bidirectional
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEGFP and human DMPK exons 11-15 with 0 CTG repeats
-
SpeciesH. sapiens (human)
-
Insert Size (bp)4300
-
Entrez GeneDMPK (a.k.a. DM, DM1, DM1PK, DMK, MDPK, MT-PK)
- Promoter tetracycline responsive and bidirectional
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CGTCGCCGTCCAGCTCGACCAG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBItetDMPKSGFP was a gift from Thomas Cooper (Addgene plasmid # 96903 ; http://n2t.net/addgene:96903 ; RRID:Addgene_96903) -
For your References section:
RNase H-mediated degradation of toxic RNA in myotonic dystrophy type 1. Lee JE, Bennett CF, Cooper TA. Proc Natl Acad Sci U S A. 2012 Mar 13;109(11):4221-6. doi: 10.1073/pnas.1117019109. Epub 2012 Feb 27. 10.1073/pnas.1117019109 PubMed 22371589