pBItetDMPKSGFP
(Plasmid
#96903)
-
Purposetet inducible bidirectional plasmid expressing GFP in one direction and in the other a human DMPK genomic segment containing exons 11-15 with 0 CTG repeats in exon 15 located
-
Depositing Lab
-
Depositing OrganizationBaylor College of Medicine
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 96903 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 96903-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 96903-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepBiTet
- Backbone size w/o insert (bp) 2800
- Total vector size (bp) 7100
-
Vector typeMammalian Expression ; tetracycline responsive and bidirectional
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEGFP and human DMPK exons 11-15 with 0 CTG repeats
-
SpeciesH. sapiens (human)
-
Insert Size (bp)4300
-
Entrez GeneDMPK (a.k.a. DM, DM1, DM1PK, DMK, MDPK, MT-PK)
- Promoter tetracycline responsive and bidirectional
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CGTCGCCGTCCAGCTCGACCAG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 96903-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 96903-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBItetDMPKSGFP was a gift from Thomas Cooper (Addgene plasmid # 96903 ; http://n2t.net/addgene:96903 ; RRID:Addgene_96903) -
For your References section:
RNase H-mediated degradation of toxic RNA in myotonic dystrophy type 1. Lee JE, Bennett CF, Cooper TA. Proc Natl Acad Sci U S A. 2012 Mar 13;109(11):4221-6. doi: 10.1073/pnas.1117019109. Epub 2012 Feb 27. 10.1073/pnas.1117019109 PubMed 22371589
