Skip to main content

pTH847-gst-optsc
(Plasmid #96908)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 96908 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBEVY-U
  • Backbone manufacturer
    C. A. I. Miller, M. A. Martinat, and L. E. Hyman (1998) Nucleic Acids Res., vol. 26, no. 15, pp. 3577–3583.
  • Backbone size w/o insert (bp) 6534
  • Total vector size (bp) 7242
  • Vector type
    Yeast Expression
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    yeast codon optimised glutathione-S transferase
  • Species
    synthetic construct
  • Insert Size (bp)
    694
  • GenBank ID
    LT856599.1
  • Promoter TDH3
  • Tag / Fusion Protein
    • 8xhistidine (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer ctaataagtatataaagaacggtagg
  • 3′ sequencing primer tggaaaagggtcaaatcgttggta
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTH847-gst-optsc was a gift from Tobias von der Haar (Addgene plasmid # 96908 ; http://n2t.net/addgene:96908 ; RRID:Addgene_96908)
  • For your References section:

    Codon-Dependent Translational Accuracy Controls Protein Quality in Escherichia coli but not in Saccharomyces cerevisiae. Jossé L, Sampson CDD, Tuite MF, Howland K, von der Haar T. bioRxiv 200006 10.1101/200006