Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open and shipping orders.

  • Pending order? We will email to confirm that your organization can accept shipments.
  • Conducting coronavirus or COVID-19 research? Email us at [email protected] with your order or deposit number so we can prioritize it.

Learn more about our current shipping status and COVID-19 resources.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #96998)


Item Catalog # Description Quantity Price (USD)
Plasmid 96998 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
    pGEM GST vector
  • Backbone size w/o insert (bp) 4800
  • Total vector size (bp) 9800
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    S. pombe (fission yeast)
  • Insert Size (bp)
  • Mutation
    ish1 C-terminal domain fused with mCherry + ura4(+)
  • Entrez Gene
    ish1 (a.k.a. SPBC365.12c)
  • Promoter N/A
  • Tags / Fusion Proteins
    • mCherry (C terminal on insert)
    • GST (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCTGTTCCTAATTGGGCTGC
  • 3′ sequencing primer ctccactaactcgtttccaaca
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMGF172 was a gift from Adam Frost & Wesley Sundquist (Addgene plasmid # 96998 ; ; RRID:Addgene_96998)
  • For your References section:

    LEM2 recruits CHMP7 for ESCRT-mediated nuclear envelope closure in fission yeast and human cells. Gu M, LaJoie D, Chen OS, von Appen A, Ladinsky MS, Redd MJ, Nikolova L, Bjorkman PJ, Sundquist WI, Ullman KS, Frost A. Proc Natl Acad Sci U S A. 2017 Mar 14;114(11):E2166-E2175. doi: 10.1073/pnas.1613916114. Epub 2017 Feb 27. 10.1073/pnas.1613916114 PubMed 28242692