Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #96999)


Item Catalog # Description Quantity Price (USD)
Plasmid 96999 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 6100
  • Total vector size (bp) 10000
  • Vector type
    Yeast Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Insert Size (bp)
  • Promoter Pnmt1
  • Tag / Fusion Protein
    • NLS-GFP (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATGAGTCCAAAGAAGAAGA
  • 3′ sequencing primer CCAGTTGGTCTGGTGTCAAAAATAA
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMGF173 was a gift from Adam Frost & Wesley Sundquist (Addgene plasmid # 96999 ; ; RRID:Addgene_96999)
  • For your References section:

    LEM2 recruits CHMP7 for ESCRT-mediated nuclear envelope closure in fission yeast and human cells. Gu M, LaJoie D, Chen OS, von Appen A, Ladinsky MS, Redd MJ, Nikolova L, Bjorkman PJ, Sundquist WI, Ullman KS, Frost A. Proc Natl Acad Sci U S A. 2017 Mar 14;114(11):E2166-E2175. doi: 10.1073/pnas.1613916114. Epub 2017 Feb 27. 10.1073/pnas.1613916114 PubMed 28242692