Skip to main content

pINDUCER-21-RUNX1
(Plasmid #97043)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 97043 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pINDUCER-21
  • Backbone manufacturer
    Stephen Elledge, Thomas Westbrook
  • Backbone size w/o insert (bp) 12152
  • Total vector size (bp) 11908
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Runt Related Transcription Factor 1
  • Alt name
    RUNX1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1443
  • Entrez Gene
    RUNX1 (a.k.a. AML1, AML1-EVI-1, AMLCR1, CBF2alpha, CBFA2, EVI-1, PEBP2aB, PEBP2alpha)
  • Promoter Tet on

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
  • 3′ sequencing primer TCTGGGACGTCGTATGGGTA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene NGS results found that the RUNX1 translation continues into and past the attB2 site, resulting in extra amino acids LPTFLYKVVDIQHSGGRSSLEGPRFE at the C-terminus of the protein, before the HA tag. The depositing laboratory states that this is an expected addition to the protein

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pINDUCER-21-RUNX1 was a gift from George Daley (Addgene plasmid # 97043 ; http://n2t.net/addgene:97043 ; RRID:Addgene_97043)
  • For your References section:

    Haematopoietic stem and progenitor cells from human pluripotent stem cells. Sugimura R, Jha DK, Han A, Soria-Valles C, da Rocha EL, Lu YF, Goettel JA, Serrao E, Rowe RG, Malleshaiah M, Wong I, Sousa P, Zhu TN, Ditadi A, Keller G, Engelman AN, Snapper SB, Doulatov S, Daley GQ. Nature. 2017 May 17. doi: 10.1038/nature22370. 10.1038/nature22370 PubMed 28514439