-
PurposeExpresses LCOR, P2A, HOXA9, T2A and HOXA5 in mammalian cells. *Please see notes below on P2A cleaving efficiency.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 97044 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepINDUCER-21
-
Backbone manufacturerStephen Elledge, Thomas Westbrook
- Backbone size w/o insert (bp) 12152
- Total vector size (bp) 13411
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameLigand Dependent Nuclear Receptor Corepressor, Runt-related transcription factor 1, ETS-related gene
-
Alt nameLCOR, HOXA9, HOXA5 seperated by a 2A peptide
-
SpeciesH. sapiens (human)
- Promoter Tet on
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
- 3′ sequencing primer TCTGGGACGTCGTATGGGTA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: due to an unforeseen error in the original publication describing the minimal P2A self-cleaving peptide [https://www.pnas.org/content/106/13/5449] the expressed transgenes are not effectively cleaved. A new version of this plasmid has been redesigned with the corrected self-cleaving sequence. The new version is available through Addgene as Plasmid 154088: pINDUCER-21-LCOR-P2A-HOXA9-T2A-HOXA5-IMPROVED.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pINDUCER-21-LCOR-P2A-HOXA9-T2A-HOXA5 was a gift from George Daley (Addgene plasmid # 97044 ; http://n2t.net/addgene:97044 ; RRID:Addgene_97044) -
For your References section:
Haematopoietic stem and progenitor cells from human pluripotent stem cells. Sugimura R, Jha DK, Han A, Soria-Valles C, da Rocha EL, Lu YF, Goettel JA, Serrao E, Rowe RG, Malleshaiah M, Wong I, Sousa P, Zhu TN, Ditadi A, Keller G, Engelman AN, Snapper SB, Doulatov S, Daley GQ. Nature. 2017 May 17. doi: 10.1038/nature22370. 10.1038/nature22370 PubMed 28514439