-
PurposeLentiviral expression of copGFP-T2A-FLuc under control of a COL2A1-based, chondrogenesis-responsive promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 97210 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGreenFire1-mCMV (pTRH1 mCMV dscGFP T2A Fluc)
-
Backbone manufacturerSystem Biosciences
- Backbone size w/o insert (bp) 8540
- Total vector size (bp) 8808
-
Modifications to backboneRemoval of mCMV sequence (139 bp) between SpeI and BamHI sites during subcloning of COL2A1 regulatory elements
-
Vector typeMammalian Expression, Lentiviral, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name4 repeats of COL2A1 intronic enhancer (+2126/+2174) upstream of core promoter (-164/+37)
-
Alt nameCOL2A1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)407
-
Entrez GeneCOL2A1 (a.k.a. ANFH, AOM, COL11A3, SEDC, STL1)
- Promoter COL2A1 regulatory elements
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer AGTGAACGGATCTCGACGGTATC
- 3′ sequencing primer CTTCATCTTGTTGGTCATGCGGC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byInsert synthesized by GenScript prior to subcloning into pGreenFire1-mCMV
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This construct can be used for reporting chondrogenic differentiation by transduced stem/progenitor cells.
An NheI site has been placed in between the 4 x enhancer repeats and the core COL2A1 promoter. This will allow those repeats to be removed, if desired (by SpeI and NheI digestion). It will also allow an additional set of repeats to be added (i.e., increasing the total to 8) after NheI digestion of the destination vector.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGF1-4eCOL2A1 was a gift from Ryan Porter (Addgene plasmid # 97210 ; http://n2t.net/addgene:97210 ; RRID:Addgene_97210) -
For your References section:
Specific, sensitive and stable reporting of human mesenchymal stromal cell chondrogenesis. De La Vega RE, Scheu M, Brown LA, Evans C, Ferreira E, Porter RM. Tissue Eng Part C Methods. 2019 Feb 6. doi: 10.1089/ten.TEC.2018.0295. 10.1089/ten.TEC.2018.0295 PubMed 30727864