-
PurposeTET driver for amplified expression in cortical neurons
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 97411 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 6329
- Total vector size (bp) 7076
-
Modifications to backbonemouse thy1PSs promoter
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametTA
-
Alt nametTA2, tet-advanced
-
SpeciesE. coli, herpes simplex virus
-
Insert Size (bp)747
- Promoter mouse thy1PSs
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GGGTATGATGCCTGTCCAGC
- 3′ sequencing primer TTATTAGGACAAGGCTGGTG
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The thy1S promoter used in this vector was originally provided by Dr. Kawaski in Kanazawa university. The reference for the original work is "Ako et al (2011) Simultaneous visualization of multiple neuronal properties with single-cell resolution in the living rodent brain. Mol Cell Neurosci 48:246–257." We shortened their sequence to accommodate in the AAV vector. It was originally used to sparsely label the marmoset neurons (ref: Sadakane et al. In Vivo Two-Photon Imaging of Dendritic Spines in Marmoset Neocortex(1,2,3). eNeuro. 2015 Sep17;2(4).). For two-photon calcium imaging, we used the vector at high concentration, at which condition, there seems to be low cell type specificity.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV_Thy1StTA was a gift from Tetsuo Yamamori (Addgene plasmid # 97411 ; http://n2t.net/addgene:97411 ; RRID:Addgene_97411) -
For your References section:
Long-Term Two-Photon Calcium Imaging of Neuronal Populations with Subcellular Resolution in Adult Non-human Primates. Sadakane O, Masamizu Y, Watakabe A, Terada S, Ohtsuka M, Takaji M, Mizukami H, Ozawa K, Kawasaki H, Matsuzaki M, Yamamori T. Cell Rep. 2015 Dec 1;13(9):1989-99. doi: 10.1016/j.celrep.2015.10.050. Epub 2015 Nov 19. 10.1016/j.celrep.2015.10.050 PubMed 26655910