Skip to main content
Addgene

pAAV_Thy1StTA
(Plasmid #97411)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 97411 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAAV
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 6329
  • Total vector size (bp) 7076
  • Modifications to backbone
    mouse thy1PSs promoter
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    tTA
  • Alt name
    tTA2, tet-advanced
  • Species
    E. coli, herpes simplex virus
  • Insert Size (bp)
    747
  • Promoter mouse thy1PSs

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GGGTATGATGCCTGTCCAGC
  • 3′ sequencing primer TTATTAGGACAAGGCTGGTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The thy1S promoter used in this vector was originally provided by Dr. Kawaski in Kanazawa university. The reference for the original work is "Ako et al (2011) Simultaneous visualization of multiple neuronal properties with single-cell resolution in the living rodent brain. Mol Cell Neurosci 48:246–257." We shortened their sequence to accommodate in the AAV vector. It was originally used to sparsely label the marmoset neurons (ref: Sadakane et al. In Vivo Two-Photon Imaging of Dendritic Spines in Marmoset Neocortex(1,2,3). eNeuro. 2015 Sep17;2(4).). For two-photon calcium imaging, we used the vector at high concentration, at which condition, there seems to be low cell type specificity.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV_Thy1StTA was a gift from Tetsuo Yamamori (Addgene plasmid # 97411 ; http://n2t.net/addgene:97411 ; RRID:Addgene_97411)
  • For your References section:

    Long-Term Two-Photon Calcium Imaging of Neuronal Populations with Subcellular Resolution in Adult Non-human Primates. Sadakane O, Masamizu Y, Watakabe A, Terada S, Ohtsuka M, Takaji M, Mizukami H, Ozawa K, Kawasaki H, Matsuzaki M, Yamamori T. Cell Rep. 2015 Dec 1;13(9):1989-99. doi: 10.1016/j.celrep.2015.10.050. Epub 2015 Nov 19. 10.1016/j.celrep.2015.10.050 PubMed 26655910