BB1_34_RPL2Att
(Plasmid
#98528)
-
PurposeBB1 with insert: RPL2Att
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 98528 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneBB1
- Backbone size w/o insert (bp) 1936
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRPL2Att
-
Insert Size (bp)504
-
MutationInternal BsaI and BpiI sites removed from insert
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BpiI (destroyed during cloning)
- 3′ cloning site BpiI (destroyed during cloning)
- 5′ sequencing primer GACAGGTCTCCGCTTCTATGTAACTAACGAAACAGCAT
- 3′ sequencing primer GATCGGTCTCCAGCGGTCAATCCCTTCTAACACAA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
BB1_34_RPL2Att was a gift from Brigitte Gasser & Diethard Mattanovich & Michael Sauer (Addgene plasmid # 98528 ; http://n2t.net/addgene:98528 ; RRID:Addgene_98528) -
For your References section:
GoldenPiCS: a Golden Gate-derived modular cloning system for applied synthetic biology in the yeast Pichia pastoris. Prielhofer R, Barrero JJ, Steuer S, Gassler T, Zahrl R, Baumann K, Sauer M, Mattanovich D, Gasser B, Marx H. BMC Syst Biol. 2017 Dec 8;11(1):123. doi: 10.1186/s12918-017-0492-3. 10.1186/s12918-017-0492-3 PubMed 29221460