-
PurposeProduces lambda Red and Cpf1 for recombination and selection. The plasmid is combined with a donor plasmid (with crRNA and template) for rapid genome editing in E.coli.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 98592 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepKD46
-
Backbone manufacturerDatsenko KA & Wanner BL (PMID:10829079)
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameFnCpf1
-
SpeciesFrancisella
-
MutationCodon optimized for E. coli
- Promoter araBAD
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer pBAD-F (ATGCCATAGCATTTTTATCC)
- 3′ sequencing primer rrnB-T1-term-Rev (GAAAGGCCCAGTCTTTCGAC) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p46Cpf1-OP2 was a gift from Qiong Wu (Addgene plasmid # 98592 ; http://n2t.net/addgene:98592 ; RRID:Addgene_98592) -
For your References section:
A Multiplex Genome Editing Method for Escherichia coli Based on CRISPR-Cas12a. Ao X, Yao Y, Li T, Yang TT, Dong X, Zheng ZT, Chen GQ, Wu Q, Guo Y. Front Microbiol. 2018 Oct 9;9:2307. doi: 10.3389/fmicb.2018.02307. eCollection 2018. 10.3389/fmicb.2018.02307 PubMed 30356638