pRL_CT_GI_del1
(Plasmid
#98744)
-
PurposeFor red/far-red light-regulated gene expression in Saccharomyces cerevisiae. Integrates into the yeast ura3-52 locus. Encodes constitutively expressed PhyBNT-synTALE-DBD and PIF3-NLS-VP64AD fusions.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 98744 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepL1A-lc
- Backbone size w/o insert (bp) 4300
- Total vector size (bp) 13000
-
Modifications to backboneAdditional Leu marker, additional integration cassette for the ura3-52 locus
-
Vector typeYeast Expression, Synthetic Biology
-
Selectable markersLEU2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namephytochrome interacting factor 3
-
Alt namePIF3
-
SpeciesA. thaliana (mustard weed)
-
Insert Size (bp)1572
-
GenBank IDNM_100824
-
Entrez GenePIF3 (a.k.a. AT1G09530, F14J9.19, F14J9_19, PAP3, PHOTOCURRENT 1, PHYTOCHROME INTERACTING FACTOR 3, PHYTOCHROME-ASSOCIATED PROTEIN 3, POC1, phytochrome interacting factor 3, purple acid phosphatase 3)
- Promoter FBA1
-
Tags
/ Fusion Proteins
- SV40-NLS (C terminal on insert)
- VP64-AD (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer TTCCTTCTTCTTCGCCCA
- 3′ sequencing primer AAGAAAAGAGCCGACCAA
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namephytochrome B
-
Alt namePhyB
-
SpeciesA. thaliana (mustard weed)
-
Insert Size (bp)1863
-
Mutationmutated nucleotide 576 C to A, deleted amino acids 622-1172
-
GenBank IDNM_001335612
-
Entrez GenePHYB (a.k.a. AT2G18790, HY3, MSF3.17, MSF3_17, OOP1, OUT OF PHASE 1, PHYTOCHROME B, phytochrome B)
- Promoter TDH3
-
Tag
/ Fusion Protein
- synTALE-DBD (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer GCAATAGCGCATCAAGAAAA
- 3′ sequencing primer CCCTGAAATTATTCCCCTAC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRL_CT_GI_del1 was a gift from Bernd Müller-Röber (Addgene plasmid # 98744 ; http://n2t.net/addgene:98744 ; RRID:Addgene_98744) -
For your References section:
PhiReX: a programmable and red light-regulated protein expression switch for yeast. Hochrein L, Machens F, Messerschmidt K, Mueller-Roeber B. Nucleic Acids Res. 2017 Sep 6;45(15):9193-9205. doi: 10.1093/nar/gkx610. 10.1093/nar/gkx610 PubMed 28911120