pXY027
(Plasmid #98915)

• Purpose: Express FtsZ tagged with GFP in E coli
• Depositing Lab: Jie Xiao
• Publication: Buss et al PLoS Genet. 2015 Apr 7;11(4):e1005128. doi: 10.1371/journal.pgen.1005128. eCollection 2015 Apr.

Backbone

• Vector backbone: pCA24N
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Note the depositor uses BW25113 for molecular/imaging assays, as this strain provided a more “wild-type” background.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: FtsZ
• Species: E. coli
• Insert Size (bp): 1149
• Promoter: T5-lac
• Tag / Fusion Protein:
  • GFP (C terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: ctttcgtcttcacctcgagaaatc
• 3′ sequencing primer: gctaattaagcttggctgcaggt

Resource Information

• Supplemental Documents:
  • pXY027.gb
• A portion of this plasmid was derived from a plasmid made by: pCA24N-FtsZ-GFP from ASKA collection
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The His tag in N'-FtsZ was removed. 6bp were added between the RBS and start codon of FtsZ to decrease the expression level of FstZ-GFP.