-
PurposeExpress FtsZ tagged with GFP in E coli
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 98915 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCA24N
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsNote the depositor uses BW25113 for molecular/imaging assays, as this strain provided a more “wild-type” background.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFtsZ
-
SpeciesE. coli
-
Insert Size (bp)1149
- Promoter T5-lac
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ctttcgtcttcacctcgagaaatc
- 3′ sequencing primer gctaattaagcttggctgcaggt
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypCA24N-FtsZ-GFP from ASKA collection
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The His tag in N'-FtsZ was removed. 6bp were added between the RBS and start codon of FtsZ to decrease the expression level of FstZ-GFP.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pXY027 was a gift from Jie Xiao (Addgene plasmid # 98915 ; http://n2t.net/addgene:98915 ; RRID:Addgene_98915) -
For your References section:
A multi-layered protein network stabilizes the Escherichia coli FtsZ-ring and modulates constriction dynamics. Buss J, Coltharp C, Shtengel G, Yang X, Hess H, Xiao J. PLoS Genet. 2015 Apr 7;11(4):e1005128. doi: 10.1371/journal.pgen.1005128. eCollection 2015 Apr. PGENETICS-D-14-03238 [pii] PubMed 25848771