pJL005
(Plasmid
#92327)
-
PurposeExpress FtsZ tagged with mEos3.2 in E coli
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 92327 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCA24N
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsNote the depositor uses BW25113 for molecular/imaging assays, as this strain provided a more “wild-type” background.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFtsZ
-
SpeciesE. coli
-
Insert Size (bp)1149
- Promoter T5-lac
-
Tag
/ Fusion Protein
- mEos3.2 (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ctttcgtcttcacctcgagaaatc
- 3′ sequencing primer gctaattaagcttggctgcaggt (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJL005 was a gift from Jie Xiao (Addgene plasmid # 92327 ; http://n2t.net/addgene:92327 ; RRID:Addgene_92327) -
For your References section:
Influence of FtsZ GTPase activity and concentration on nanoscale Z-ring structure in vivo revealed by three-dimensional Superresolution imaging. Lyu Z, Coltharp C, Yang X, Xiao J. Biopolymers. 2016 Oct;105(10):725-34. doi: 10.1002/bip.22895. 10.1002/bip.22895 PubMed 27310678