Skip to main content

pJB007
(Plasmid #98995)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 98995 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCA24N
  • Backbone manufacturer
    NBRP-E.coli at NIG
  • Modifications to backbone
    replaced N-terminal 6xHis with novel SpeI site, results in 6bp reduced expression
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    For fluorescence studies, grow at RT or 30C.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FtsI
  • Species
    E. coli
  • Insert Size (bp)
    1764
  • Promoter T5-lac
  • Tag / Fusion Protein
    • TagRFP-T (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer ctttcgtcttcacctcgagaaatc
  • 3′ sequencing primer gctaattaagcttggctgcaggt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJB007 was a gift from Jie Xiao (Addgene plasmid # 98995 ; http://n2t.net/addgene:98995 ; RRID:Addgene_98995)
  • For your References section:

    GTPase activity-coupled treadmilling of the bacterial tubulin FtsZ organizes septal cell wall synthesis. Yang X, Lyu Z, Miguel A, McQuillen R, Huang KC, Xiao J. Science. 2017 Feb 17;355(6326):744-747. doi: 10.1126/science.aak9995. 10.1126/science.aak9995 PubMed 28209899