Skip to main content

pMVS102_P3-GFP-NATMX6
(Plasmid #99048)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 99048 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pFA6
  • Backbone size w/o insert (bp) 3436
  • Total vector size (bp) 7072
  • Modifications to backbone
    digested with BamHI and AscI
  • Vector type
    Yeast Expression
  • Selectable markers
    cloneNAT

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    McIsaac 2014 P3 promoter
  • Alt name
    Modified GAL1 promoter with 6 Zif268 binding sites
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    653
  • Mutation
    GAL1 promoter with 4 GAL4 sites removed and replaced with Zif268 sites

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    eGFP
  • Species
    Aequorea victoria
  • Insert Size (bp)
    717
  • Promoter McIsaac 2014 P3 promoter

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer aTGTCTAAAGGTGAAGAATTATTCA
  • 3′ sequencing primer ggacgaggcaagctaaacag
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    clonNAT resistance
  • Insert Size (bp)
    573

Cloning Information for Gene/Insert 3

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The P3 promoter sequence is from McIsaac, R. S., Gibney, P. A., Chandran, S. S., Benjamin, K. R., & Botstein, D. (2014). Synthetic biology tools for programming gene expression without nutritional perturbations in Saccharomyces cerevisiae. Nucleic Acids Research, 42(6), e48. http://doi.org/10.1093/nar/gkt1402

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMVS102_P3-GFP-NATMX6 was a gift from Barak Cohen (Addgene plasmid # 99048 ; http://n2t.net/addgene:99048 ; RRID:Addgene_99048)
  • For your References section:

    A High-Throughput Mutational Scan of an Intrinsically Disordered Acidic Transcriptional Activation Domain. Staller MV, Holehouse AS, Swain-Lenz D, Das RK, Pappu RV, Cohen BA. Cell Syst. 2018 Mar 1. pii: S2405-4712(18)30052-8. doi: 10.1016/j.cels.2018.01.015. 10.1016/j.cels.2018.01.015 PubMed 29525204