Skip to main content

pHR-Tre3G-29xGGGGCC-12xMS2
(Plasmid #99149)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 99149 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHR-TRE3G
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 8700
  • Total vector size (bp) 9790
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    29xGGGGCC 12xMS2 hairpins
  • Species
    Synthetic
  • Insert Size (bp)
    1000
  • Promoter TRE3G

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

29x GGGGCC cannot be confirmed by sequencing due to high GC content. Addgene was able to verify at least 16x repeats. Instability may be observed in the repeat region so it is recommended that multiple DNA preparations be screened.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHR-Tre3G-29xGGGGCC-12xMS2 was a gift from Ron Vale (Addgene plasmid # 99149 ; http://n2t.net/addgene:99149 ; RRID:Addgene_99149)
  • For your References section:

    RNA phase transitions in repeat expansion disorders. Jain A, Vale RD. Nature. 2017 Jun 8;546(7657):243-247. doi: 10.1038/nature22386. Epub 2017 May 31. 10.1038/nature22386 PubMed 28562589