Skip to main content

pHR-tdMCP-YFP
(Plasmid #99151)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 99151 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHR
  • Backbone size w/o insert (bp) 10000
  • Total vector size (bp) 10436
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Dimeric MS2-coat binding protein
  • Insert Size (bp)
    730
  • Promoter SFFV
  • Tag / Fusion Protein
    • eYFP (C terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AATGACCCTGCGCCTTATTT
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHR-tdMCP-YFP was a gift from Ron Vale (Addgene plasmid # 99151 ; http://n2t.net/addgene:99151 ; RRID:Addgene_99151)
  • For your References section:

    RNA phase transitions in repeat expansion disorders. Jain A, Vale RD. Nature. 2017 Jun 8;546(7657):243-247. doi: 10.1038/nature22386. Epub 2017 May 31. 10.1038/nature22386 PubMed 28562589