-
PurposeExpresses dimeric MS2-coat binding protein tagged with YFP, 2nd generation lentiviral vector
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 99151 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHR
- Backbone size w/o insert (bp) 10000
- Total vector size (bp) 10436
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDimeric MS2-coat binding protein
-
Insert Size (bp)730
- Promoter SFFV
-
Tag
/ Fusion Protein
- eYFP (C terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AATGACCCTGCGCCTTATTT
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHR-tdMCP-YFP was a gift from Ron Vale (Addgene plasmid # 99151 ; http://n2t.net/addgene:99151 ; RRID:Addgene_99151) -
For your References section:
RNA phase transitions in repeat expansion disorders. Jain A, Vale RD. Nature. 2017 Jun 8;546(7657):243-247. doi: 10.1038/nature22386. Epub 2017 May 31. 10.1038/nature22386 PubMed 28562589