pGLACTE-PseudoHT51
(Plasmid
#99257)
-
PurposeContains expanded CGG repeats (98 repeats with 2 AGG interruptions) within the 5'UTR of FMR1. Internal control with synthetic primer sequence for capillary electrophoresis
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 99257 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGL3
- Total vector size (bp) 4353
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFMR1
-
SpeciesH. sapiens (human), Synthetic
-
MutationContains synthetic, non-human, primer sequence downstream of CGG repeats
-
Entrez GeneFMR1 (a.k.a. FMRP, FRAXA, POF, POF1)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer gttgctaatgcgcgtaggat
- 3′ sequencing primer ggcacctgtcctacgagttg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
CGG repeats are moderately unstable in prolonged bacterial culture at 37C. Upon receipt select several colonies and grow overnight. Immediately make glycerol stocks and verify the insert size. Inoculate directly from glycerol and grow for ~10 hours for large scale preparations.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGLACTE-PseudoHT51 was a gift from Karen Usdin (Addgene plasmid # 99257 ; http://n2t.net/addgene:99257 ; RRID:Addgene_99257)