-
PurposeCan be used to generate AAV virus that will express mScarlet in the presence of Cre
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 99280 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backboneAAV pCAG-FLEX-tdTomato-WPRE (Addgene #51503)
-
Backbone manufacturerHongkui Zeng/Allen Institute For Brain Science
- Backbone size w/o insert (bp) 5719
- Total vector size (bp) 6440
-
Modifications to backboneA fragment containing reverse-complemented mScarlet was swapped into replace tdTomato. Total AAV packaging size (including ITRs and DNA in between) is 3843 bp.
-
Vector typeAAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemScarlet
-
Alt namemonomeric Scarlet
-
Alt namemScarlet red fluorescent protein
-
SpeciesSynthetic
-
Insert Size (bp)696
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site FseI (not destroyed)
- 5′ sequencing primer gcaacgtgctggttattgtg
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bymScarlet was synthesized de novo based on sequences published by Theodorus W J Gadella Jr's laboratory (Bindels et al, 2017, Nature Methods, PMID:27869816)
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The stop codon for mRuby3 ends 24 bp downstream of the gene, adding an additional 8 amino acids to the protein. However, this is not expected to impact the function of the protein.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV pCAG-FLEX-mScarlet-WPRE was a gift from Rylan Larsen (Addgene plasmid # 99280 ; http://n2t.net/addgene:99280 ; RRID:Addgene_99280)