pMK11-01
(Plasmid
#99605)
-
PurposePlasmid containing parBp-mKate2 fusion
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 99605 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMK11
- Backbone size w/o insert (bp) 8003
- Total vector size (bp) 9544
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameparBp-mKate2
-
Insert Size (bp)1541
- Promoter PczcD
-
Tag
/ Fusion Protein
- mKate2 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site SpeI (unknown if destroyed)
- 5′ sequencing primer CGAGTCTGGTGGTTGGTAAG
- 3′ sequencing primer CGAAATACGGGCAGACATGG
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMK11-01 was a gift from Morten Kjos & Jan-Willem Veening (Addgene plasmid # 99605 ; http://n2t.net/addgene:99605 ; RRID:Addgene_99605) -
For your References section:
Chromosome segregation drives division site selection in Streptococcus pneumoniae. van Raaphorst R, Kjos M, Veening JW. Proc Natl Acad Sci U S A. 2017 Jul 3. pii: 201620608. doi: 10.1073/pnas.1620608114. 10.1073/pnas.1620608114 PubMed 28674002