Skip to main content

pMK11-02
(Plasmid #99606)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 99606 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMK11
  • Backbone size w/o insert (bp) 8003
  • Total vector size (bp) 9544
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    parBp(mut)-mKate2
  • Insert Size (bp)
    1541
  • Mutation
    internal parS-site mutated
  • Promoter PczcD
  • Tag / Fusion Protein
    • mKate2 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site SpeI (unknown if destroyed)
  • 5′ sequencing primer CGAGTCTGGTGGTTGGTAAG
  • 3′ sequencing primer CGAAATACGGGCAGACATGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMK11-02 was a gift from Morten Kjos & Jan-Willem Veening (Addgene plasmid # 99606 ; http://n2t.net/addgene:99606 ; RRID:Addgene_99606)
  • For your References section:

    Chromosome segregation drives division site selection in Streptococcus pneumoniae. van Raaphorst R, Kjos M, Veening JW. Proc Natl Acad Sci U S A. 2017 Jul 3. pii: 201620608. doi: 10.1073/pnas.1620608114. 10.1073/pnas.1620608114 PubMed 28674002