Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #85588)


Item Catalog # Description Quantity Price (USD)
Plasmid 85588 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 8273
  • Total vector size (bp) 11911
  • Modifications to backbone
    gfp_sf gene was removed; dCas9sp gene driven by IPTG inducible promoter PL was inserted
  • Vector type
    Bacterial Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    Streptococcus pyogenes
  • Insert Size (bp)
  • Promoter PLsp

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (unknown if destroyed)
  • 3′ cloning site SalI (unknown if destroyed)
  • 5′ sequencing primer TCTCATAGGCCGGCCTGTTAG
  • 3′ sequencing primer gctttgctataaatacgcttcacag
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    dCas9sp was amplified from plasmid Addgene #44249
  • Terms and Licenses
  • Article Citing this Plasmid

Depositor Comments

To find information of pJWV100, please refer to "Overkamp W, Beilharz K, Detert Oude Weme R, Solopova A, Karsens H, Kovacs A, Kok J, Kuipers OP, Veening JW (2013) Benchmarking various green fluorescent protein variants in Bacillus subtilis, Streptococcus pneumoniae, and Lactococcus lactis for live cell imaging. Applied and environmental microbiology 79: 6481-6490";
To find information of IPTG-inducible promoter, PL, please refer to "Robin Sorg, PhD thesis, Engineering Approaches to Investigate Pneumococcal Gene Expression Regulation and Antibiotic Resistance Development, 2016, ISBN: 978-90-367-9259-2"

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJWV102-PL-dCas9 was a gift from Jan-Willem Veening (Addgene plasmid # 85588 ; ; RRID:Addgene_85588)
  • For your References section:

    High-throughput CRISPRi phenotyping identifies new essential genes in Streptococcus pneumoniae. Liu X, Gallay C, Kjos M, Domenech A, Slager J, van Kessel SP, Knoops K, Sorg RA, Zhang JR, Veening JW. Mol Syst Biol. 2017 May 10;13(5):931. doi: 10.15252/msb.20167449. PubMed 28490437