pPEPZ-sgRNAclone
(Plasmid #141090)

• Purpose: This vector is designed for efficient cloning of sgRNAs by Golden Gate assembly. The sgRNA insertion leads to replacement of mCherry, resulting in loss of red color of E. coli colony.
• Depositing Lab: Jan-Willem Veening
• Publication: Liu et al Cell Host Microbe. 2021 Jan 13;29(1):107-120.e6. doi: 10.1016/j.chom.2020.10.001. Epub 2020 Oct 28.

Backbone

• Vector backbone: pPEPZ
• Backbone size w/o insert (bp): 4416
• Total vector size (bp): 5155
• Vector type: Bacterial Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mCherry
• gRNA/shRNA sequence: structure sequence: dCas9 handle binding and terminator sequence
• Species: Synthetic
• Promoter: p3

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmBI (destroyed during cloning)
• 3′ cloning site: BsmBI (destroyed during cloning)
• 5′ sequencing primer: aattcggtcgacagatcttcg
• 3′ sequencing primer: caagcagaagacggcatacg

Resource Information

• Supplemental Documents:
  • pPEPZ-sgRNAclone.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry