Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #99612)


Item Catalog # Description Quantity Price (USD)
Plasmid 99612 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 4107
  • Total vector size (bp) 11746
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
  • Alt name
  • Species
  • Promoter PczcD

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GCCCAGTCCTGCTCGC
  • 3′ sequencing primer CGAAATACGGGCAGACATGG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJWV102-wtcas9sp was a gift from Morten Kjos & Jan-Willem Veening (Addgene plasmid # 99612 ; ; RRID:Addgene_99612)
  • For your References section:

    Chromosome segregation drives division site selection in Streptococcus pneumoniae. van Raaphorst R, Kjos M, Veening JW. Proc Natl Acad Sci U S A. 2017 Jul 3. pii: 201620608. doi: 10.1073/pnas.1620608114. 10.1073/pnas.1620608114 PubMed 28674002