Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #85590)


Item Catalog # Description Quantity Price (USD)
Plasmid 85590 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 3245
  • Total vector size (bp) 3415
  • Modifications to backbone
    Chloramphenicol resistance marker was removed; gBlock of sgRNA targeting firefly luciferase encoding gene luc was inserted by BglII and BamHI digestion and ligation
  • Vector type
    Bacterial Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    Spectinomycin 100 μg/ml
  • Copy number
    High Copy


  • Gene/Insert name
    sgRNA targeting firefly luciferase encoding gene
  • Alt name
  • Species
  • Insert Size (bp)
  • Promoter P3

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer TCTAGACGGTGATCAACACGCTAG
  • 3′ sequencing primer CGAGGGATTTGGTGATTCTTCTT
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

For information of vector pPEP1 and promoter of P3, please refer to
"Sorg RA, Kuipers OP, Veening JW (2014) Gene Expression Platform for Synthetic Biology in the Human Pathogen Streptococcus pneumoniae. ACS synthetic biology"

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPEPX-P3-sgRNAluc was a gift from Jan-Willem Veening (Addgene plasmid # 85590 ; ; RRID:Addgene_85590)
  • For your References section:

    High-throughput CRISPRi phenotyping identifies new essential genes in Streptococcus pneumoniae. Liu X, Gallay C, Kjos M, Domenech A, Slager J, van Kessel SP, Knoops K, Sorg RA, Zhang JR, Veening JW. Mol Syst Biol. 2017 May 10;13(5):931. doi: 10.15252/msb.20167449. PubMed 28490437