pPEPX-P3-sgRNAluc
(Plasmid #85590)

• Purpose: Integrate plasmid of Streptococcus pneumoniae, which can integrate sgRNA targeting luc gene, which encode luciferase, into the locus between amiF and treR. This vector can be used as the template for
• Depositing Lab: Jan-Willem Veening
• Publication: Liu et al Mol Syst Biol. 2017 May 10;13(5):931. doi: 10.15252/msb.20167449.

Backbone

• Vector backbone: pPEP1
• Backbone size w/o insert (bp): 3245
• Total vector size (bp): 3415
• Modifications to backbone: Chloramphenicol resistance marker was removed; gBlock of sgRNA targeting firefly luciferase encoding gene luc was inserted by BglII and BamHI digestion and ligation
• Vector type: Bacterial Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Spectinomycin 100 μg/ml
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: sgRNA targeting firefly luciferase encoding gene
• Alt name: sgRNAluc
• Species: Synthetic
• Insert Size (bp): 140
• Promoter: P3

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (unknown if destroyed)
• 3′ cloning site: BamHI (unknown if destroyed)
• 5′ sequencing primer: TCTAGACGGTGATCAACACGCTAG
• 3′ sequencing primer: CGAGGGATTTGGTGATTCTTCTT

Resource Information

• Supplemental Documents:
  • pPEPX-P3-sgRNAluc.gbk
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

For information of vector pPEP1 and promoter of P3, please refer to
"Sorg RA, Kuipers OP, Veening JW (2014) Gene Expression Platform for Synthetic Biology in the Human Pathogen Streptococcus pneumoniae. ACS synthetic biology"